Euphytica (2000) Download (Lössl et al. 2000) as PDF, 87 kb

Molecular markers for cytoplasm in potato:
Male sterility and contribution of different plastid-mitochondrial configurations to starch production

A. Lössl 1, 2, M. Götz 1, A. Braun 1, G. Wenzel 1

1  Lehrstuhl für Pflanzenbau und Pflanzenzüchtung, TU München-Weihenstephan, D-85354 Freising (Germany),
2  Institute of Botany, Ludwig Maximilian University, Menzinger Str.67, München (Germany).
Abstract
Text
References
Acknowledgments


Abstract 

Distinct parental cytoplasms were combined in symmetric tetraploid hybrids of potato by somatic cell fusion. This allowed, in the presence of nearly isogenic nuclear genomes, to estimate the contribution of mitochondrial (mt) and chloroplast (cp) genomes to starch content. Analysis of mt-cp configurations in the complete gene pool of german potato cultivars [2n=4x], in a reciprocal dihaploid population [2n=2x], in di-haploid fusion parents [2n=2x] and in their respective hybrids [2n=4x] made visible the effects of different cytoplasmic backgrounds and mitochondrial subgenomic rearrangements.
Genotypes identified by markers as cytoplasm Wg were associated with cytoplasmic male sterility. Evaluation of cytoplasmic types lead to the conclusion, that in starch content the ´wild type´ cytoplasms
Wa  and Wg have a significant advantage to other cytoplasmic types (T b,W d and S e). This results from the experiments with a reciprocal population, 180 di-haploids, and from cultivar  comparisons.
In hybrids an interaction between starch content and different mt-cp combinations could be found.
In general the highest field performance, measured in starch content and yield was associated with such cytoplasmic configurations which appeared to a high frequency within a population, when the segregation process was completed. This fact is explained by a selection advantage of  clones with optimized organellar segregation already during in vitro phase. PCR markers for cytoplasm differentiation are actualized on a website.

Key words: potato, plastid, cytoplasm, male sterility, starch, somatic hybrids
 



Introduction

In most cases the influence of the type of cytoplasm is not distinguished from  biparental inherited traits. Moreover, cytoplasmic phenotypes only occur in combination with distinct nuclear back-grounds and this hampers their recognition in further breeding work. Unintended counterselection against some organellar types may take place, as long as the agronomic value of different cyto-plasms remains unknown.  Information about these influences is valuable for selection in sexual breeding but also for production of somatic fusion hybrids.
Following determination of different cytoplasmic types, cytoplasmic, and in part maternal effects can be detected in at least three ways:
1.) Comparison of gene pools of clones (4X cultivars), di-haploids (2X breeding clones),
2.) Comparison of reciprocal populations, and
3.) Comparison of somatic hybrids containing different cp/mt configurations with nearly identical nuclear genomes.
In conventionally bred clones an optimized nuclear-cytoplasmic interaction can be achieved in several traits. This was proven by experiences of conventional plant breeding where reciprocal crosses show differences between cytoplasms: in this respect differences in the photoperiod reaction of different plasms (Sanford and Hannemann 1982) are relevant as well as maternal effects, reported by Maris (1989) who analyzed a series of diallel crosses between ssp. tuberosum and adapted ssp. andigena varieties: populations with tuberosum cytoplasm were found to be superior in respect to tuber yield whereas the andigena cytoplasm provided a higher male fertility. Hilali et al. (1987) observed reciprocal differences in tuber yield, tuber number, vine vigor, average tuber weight, seed germination and pollen vitality. In cytoplasmic substitution backcrosses of potato Amoah et al. (1988) found reciprocal differences between S. phureja and S. tuberosum backcross progenies.
Nevertheless maternal effects on field performance which are dependent on interorganellar energy metabolism as is starch accumulation and degradation have not been reported so far. This might have been due to the lack of markers capable to differ between cytoplasmic types.
In conventional breeding the differences in sterility, tuber characteristics, seed production and germination are conditioned unlikely by cytoplasmic factors alone. For this reason it is useful to analyze symmetric hybrids, which possess isogenic nuclear genomes and different cytoplasmic backgrounds. By this constellation the effects of various cytoplasms and of plastid-mitochondrial (cp-mt) interaction can be separated from nuclear differences.
In contrast to sexual combinations in somatic fusion the genetic information of the cytoplasms is biparentally inherited. Therefore it is relevant to investigate the influence of the different cp / mt configurations after segregation within a hybrid population, generated in fusion experiments (Schilde-Rentschler et al. 1995, Cardi et al. 1999).
Field trials show variability between hybrid clones from the same parents. This variability can be due to nuclear deviations and different cytoplasmic configurations. The latter were analyzed in detail in an investigation of  the fate of organelles after cell fusion by Lössl et al. (1999). The characterization of  potato cytoplasms in five main cp/mt types Wa  T b,Wg,W d and S e was a precondition for the detection of correlations between cytoplasm and phenotypic data. A set of probes and PCR primers useful for the quick characterization of breeding material was developed and actualized on a website.
Novel configurations of cytoplasmic types occurred in fusion hybrids in shape of partial or complete additions of parental fragments and even novel fragments. In fusion hybrids the strict assortment of cp and mt types was lacking; within regenerants of potato, plastids segregate completely into one of the parental types, whereas mitochondrial genomes are affected from various portions of rearrangements. Cp/mt differentiation serves as a basis for a subsequent evaluation of cytoplasmically influenced traits.
In symmetric hybrids with isogenic nuclear genomes - neglecting protoclonal variation - it could be shown that in general a low degree of chondriome recombination correlated positively with yield potential (Lössl et al. 1994). The question arose, whether mitochondrial performance is influenced by distinct chondriome regions and whether they can interact more efficiently with the new generated genome if they derive from a special parent (Lössl 1996; Frei et al. 1998). An evaluation of traits being influenced by cytoplasm, is expected to allow predictions about the effects of distinct cytoplasmic configurations for breeding purposes.


Material and Methods

Molecular Markers
Restriction fragments specific for the different cytoplasmic types (a, b,g,d,e, k) were cloned and sequenced according to Sanger (1977). The potato mtDNA probes, used in this work can be supplied on request. PCR primers specific for mitochondrial types (a, b, g)  were designed, with the pairs of primers used to detect mt type g associated with cytoplasmic male sterility (CMS). They are given in Table 1.
Nearly the complete spectrum of the german cultivar sortiment and 180 dihaploid clones were analyzed on their cytoplasms. Using 4 pairs of PCR primers, and 11 homologous mt-probes they were grouped as mt types a,b,g,d,e and k.
Optimal annealing temperature for mt primers was 57°C, and for cp primers ALC_1 and ALC_3, to differ between cp type T and wild type plastids (cp type W or S) 44°C. The markers were used for the estimation of cytoplasm frequencies within the german potato gene pool (Table 2). Plastid type nomenclature was used according to Hosaka and Hannemann (1988).
The fusion hybrids have been checked for their deviations in their nuclear genomes by usage of a set of probes, which covered the 12 chromosomes as performed by Lössl et al. (1994).

Phenotypic evaluation
For the present analysis fusion populations which yielded about 30 hybrid clones, each going back to a single fusion event, were chosen. Fusion hybrids and the dihaploid material derived from the Technical University Munich and from the Institute for Resistance Genetics (Bundesanstalt für Züchtungsforschung) in D-85461 Grünbach. A reciprocal F1 population (Table 3) was provided by Dr. Uhrig, MPI Cologne. Fusion populations employed in this work are listed in Table 4.
Field experiments, performed during four years, consisted of blocks in two and three replications with approximately 3,5 m2 and 16 plants per field plot. Data were evaluated at two locations: in the experimental fields of the Institute for Resistance Genetics, Grünbach and at Roggenstein (Oberbayern) and of the Technical University Munich. Populations (Pop), which were basis for highly significant observations (P=0,01), consisted of more than 30 hybrids. Pop Ia [FAL2 (+) 601] consisted of 35 symmetric hybrids, grown in nine replications, Pop Ib [BP32 (+) 601] of 55 hybrids in two replications, Pop Ic [2006 (+) 626] of 6 hybrids in five replications, Pop IVb [FAL2 (+) M9] of 32 hybrids in two replications, Pop IIc [26-2 (+) 1512_25] of 17 hybrids in five replications, Pop IIIb [2006-10 (+) 576-16] of 10 hybrids in five replications, Pop IVa [BP32 (+) M9] of 58 hybrids in 6 replications, where two plots were lost. They were calculated as an imbalanced trial. Additional field data for the various cultivars were given by the German Seed Board from the “BundesSortenamt”. Starch and dry matter was determined using a starch weighing machine type MEKU (Pollähne, D-30974 Wennigsen, Germany). For the calculation of the influence of different cytoplasmic compositions on yield components ANOVA and non parametric statistical ´SPSS´ programs for imbalanced groups were used.
Test for pollen fertility and vitality was carried out by staining procedures and germinating tests respectively (Stanley and Linskens 1974).


Results

Differentiation of Cytoplasms
Within 4X cultivars predominantly the cp/mt types Wa  T b,Wg occurred. Table 2 gives the percentages for this mt type distribution within the German cultivars.
By usage of  DNA markers  (probes and PCR primers) it is now easy to differ between the cytoplasmic types of potato mt-a, b, g.  Figure 1 shows a comparison of cytoplasmic types Wa  T b,Wg with the specific PCR primers. The primers ALM_1, ALM_3, ALM_4, ALM_5, ALM_6 and ALM_7 in combination with ALC_1 and ALC_3 as well as the probes m79, m80, m93, and m112 can be applied as markers. They detect mt type g, which is associated with the phenotype of cytoplasmic male sterility. The set of probes for determination of  mitochondrial and plastid genome types was tested in non-radioactive hybridization. In this way breeders can perform DNA analysis without isotopic laboratory.

Comparison of field data to cytoplasmic configurations
In order to detect advantageous effects of distinct cytoplasmic types, the di-haploid genotypes, hybrid populations, the reciprocal F1 population (US1) and the whole spectrum of German cultivars, were grouped according to their organellar types and compared in agronomically interesting traits. For this purpose their starch contents, yields and fertility were evaluated (Table 3, Table 4). Cytoplasmic male sterility (CMS) was confirmed by pollen germination tests. Most of the CMS genotypes could be traced back to ancient genotypes as are: I-301, MPI 61-303/34, 56.4129/288, MPI 46.956/68 and Röslau. This maternally inherited sterility was correlated with clones containing mt type g, as are Aiko, Alwara, Assia, Azur, Bettina, Forelle, Fox, Heidrun, Helios, Petra, Sibu, Uno and Ute.

Cultivars and di-haploid breeding clones
Correlation of field data with cytoplasmic types showed differences between the cytoplasmic groups. Comparison of the cytoplasmic types by Kruskal-Wallis one-way-anova resulted in significantly higher starch contents of varieties with Wa and Wg type than those with Tb types (P=0,01). The effective difference between culture type (T b) and wild type (Wa, g) was 14,7% vs. 16,2%. This clear difference was reduced, but still existent, if starch yield was considered (P=0,05). With slight deviations the field data, measured in this trial, were consistent with the data given by the German Seed Board (“Beschreibende Sortenliste“). In order to exclude a coherence between cytoplasmic type and nuclear genome we performed a cluster analysis by usage of nuclear genomic probes and RAPD (data not shown). Genetic distance of nuclear genomes of 144 varieties did not correlate with their assortment to different cytoplasmic groups.
According to breeders experience and pollen vitality tests nearly all cultivars identified as mt-g are male sterile. The probes and primers listed in Table 3 can be applied as CMS-markers.
Similarly as found in the cultivar pools, comparison of the cytoplasmic pools within the di-haploid clones confirmed, that the mt-b pool had significantly lower starch contents than those with the "wilder" plasms mt- a,g,d,e. In contrast to the varieties this was associated with a shortened maturity.

Reciprocal Population
In starch content the reciprocal crossed F1 population ´US1´ revealed a significant positive effect of cytoplasm mt-a to mt-d. In view of 41 and 35 individuals per cytoplasm pool, it was empirically sure that the different nuclear alleles were represented proportionally within the two groups mt-a and mt-d. Thus they were comparable. The effective difference was 14,4% (mt-d) to 15,8% (mt-a).

Fusion populations
For a deeper elucidation of nuclear-cytoplasmic-interactions it was useful to analyze populations of somatic hybrids, with nearly identical nuclear genomes, but containing different plastid-mitochondrial configurations. In hybrids generally the highest field performance was associated with such cytoplasmic configurations which were represented to a high frequency within the concerned fusion population (e.g. Ia, Ib, IIc, IIIb, IVa). Clones, which turned out to have the highest productivity, have already been accumulated naturally during in vitro phase. This selection pressure was extremely obvious in population IIIb [W/a (+) W/d] were 2/3 of the individuals reverted to the configuration of mt type b at rps14 gene locus.
In contrast to this reconfiguration, hybrids of population IVa revealed a high correlation between homogeneous mt genomes and a high yield potential (Lössl et al. 1994). Continuous evaluation of yield data from 1994 to 1998 detected that an irregular amplification of an additional atp6 gene copy was correlated with severe depressions in starch yield. In population IVa, these 10% of hybrids, which were affected by a highly replicated additional atp6 copy (Lössl et al. 1999) had a significantly lower starch content and yield level than those which did exhibit a normal mt genome organization (P=0,01).
Within fusion population Ia plastid segregation ratio was skewed (cpW: cpT = 1: 6). In starch content hybrids containing cp type T revealed a clear advantage. But in respect to the novel organization of  the hybrids mt genomes the cp pools had to be subgrouped into mt recombination types R1 and R2 (Figure 2). In dependence of the mt type, differences could be detected in starch yield between somatic hybrids. In connection with cpW the mitochondrial recombination type R1 was superior to type R2. This correlation was inverted if mt types R1 and R2 were connected with cp T. The interaction between mt- and cp-types was significant (P=0,001). This interdependence in starch yield is shown in Figure 3.
 

Discussion
The working hypothesis of a correla-tion between cytoplasmic genome configuration and field performance measured by starch production could be confirmed in the current investigation.
Evaluation of plasm types lead to the assessment, that  in starch content  the ´wild type´ cytoplasms (W/a and W/g) are superior in comparison to other cytoplasmic types (T/b,W/d, S/e). This results from field trials with di-haploids, cultivars and a reciprocal population. W/g cytoplasm is associated with male sterility and for breeding of a high starch variety W/a  and W/g appears to be the appropriate maternal cytoplasm.
It  was generally observed that those cytoplasmic configurations, which appeared to an unproportionally high ratio in somatic fusion hybrids, were also associated with the highest field performance. This fact could be explained by a selection advantage of such clones, which works already during in vitro segregation and regeneration phase.

Conventionally bred cultivars
Field trials with varieties showed, that the advantage in starch production of cytoplasms W/a and W/g, representing the wild type cytoplasms was slightly reduced when starch yield was focused. Higher yields seem to compensate the lower starch contents to some extent. The correlation to starch content had a high significance (P= 0,01), whereas correlation of the same cytoplasms to starch yield was slightly lower, but still significant (P=0,05). If starch content and yield are considered as complementary breeding aims, the cytoplasmic advantage of W/aand W/g remains relevant for breeding a high starch cultivar.
It is suggested that cultivars with cytoplasm T/b are optimized for stable yields rather than for high starch contents. Definitely nuclear genes determine starch content and yield, but during starch accumulation and degradation they interact with factors coded by the plastid and mitochondrial genomes. For this reason the complete assortment of cultivars were in parallel investigated in view to their diversity on nuclear genome level. Following an association to cytoplasmic pools W/a, W/g and T/b the cultivars were tested, whether their cytoplasmic wild type content corresponds with different portions of wild type character in their nuclear genomes. So far there is no indication that varieties with the same cytoplasm could be grouped in the same cluster on nuclear genome level. Nuclear alleles seem to be distributed rather independent from cytoplasmic mating barriers. An exception might be the cytoplasm of W/g, which is correlated with male sterility.
Mt type g has been introduced into the German spectrum of cultivars together with PVY-virus resistance. For this purpose the maternal parents from MPI I-301 or its relative MPI-61-303-34 have been employed. These genotypes derive from a mating with a S. stoloniferum accession, containing a deviating wild type cytoplasm. Somatic fusions with a parent of mt type g generate hybrids with different portions of this CMS conferring cytoplasm. Preliminary results with the somatic hybrid populations showed, that this correlation can be broken by the novel cp-mt-configurations. By this constellation it should be possible to limit the responsible CMS. For breeding industry an application of the markers given on the website allows to spare money and time in the crossing work. The identification of male sterile genotypes enables a limitation in the selection of pollen parents. It will further be of advantage, to exchange the cytoplasms of these sterile mt-g cultivars  by the method of Spangenberg et al. (1991) or Rasmussen et al. (2000).

Somatic fusion hybrids
In general the results have to be seen in front of a distinct nuclear genome composition. They are not transferable completely to other fusion populations with similar cytoplasmic combinations.
For confirmation of the effects found, additional fusion populations have to be analyzed; on the other hand it is necessary to check their nuclear genomes for deviations. Within the populations a small portion of  somaclonal variation could be proven with a list of probes which covered the whole set of chromosomes. Due to the fact that the main part of mutations have an unfit effect, there is a negative correlation of somaclonal variation with yield parameters. But in none of the euploid hybrids the deviations caused depressions in field performance (Lössl et al. 1994).
From this we can follow, that within the concerned hybrid population the nuclear genomes are not affected from serious aberrations.
Interaction with the novel plastid-mitochondrial factors during accumulation and degradation of polysaccharides constitutes the variable field performance of individual hybrids.
The analysis of cytoplasmic organelle components within somatic hybrid populations revealed high differences between the hybrids cp and mt genomes. The skewed segregation ratio after regeneration phase of 1:6 in cp type W and T was a first indication for an advantage of distinct cytoplasms in fusion population Ia. This deviation from random plastid segregation could be due to different frequencies of replication and organelle division (Glimelius et al. 1981, Donaldson et al. 1994) and is indicative for a higher performance of cp type T during in-vitro regeneration phase.
In the analyzed populations I, II, III, IV the segregated plastid genomes did not show any recombinations and were highly conserved, whereas mitochondrial genomes of the hybrids revealed novel DNA organizations R1 and R2. On first view in population Ia somatic hybrids with cp type T had a significant advantage with respect to starch content, but additionally an interaction with the mitochondrial complement was observed by the comparison of recombinant mt genomes. Horvath et al. (1992) suggests that recombinations are processes of adaptation, which improve the nuclear-cytoplasmic interaction. The significant difference in starch yield of recombination type R1 and R2 in dependence of cp type W and T displays the association of distinct chondriome-plastome arrangements with better performance levels.
For an evaluation of this effect mt type was predominantly mentioned for Population Ia. One reason was, that population Ia had the lowest degree of deviations in nuclear genomes. Hereby the risk was reduced, that differences were due to protoclonal variation. Furthermore, in contrast to the other populations only population Ia had a skewed cp type segregation. The skewed ratio was associated with a high difference in starch content between the two groups W and T, whereas the other populations show weak or low significant correlations to starch content. All the populations Ia, Ib, Ic, IIc, IIIb, IVa, IVb are obtained  from different fusion parents. Population Ia and Ib contain different nuclear genomes. Therefore it is supposed that the effect, observed in population Ia is dependent on cytoplasmic interaction with the nuclear composition. The other populations listed, show, that there is in general a superiority of these clones, which segregated to a higher number. If this relation seemed to be otherwise, than it turned out, not to be rather significant.
In order to keep an overview, only the significant influences of organellar configurations are stated. Homogeneous mt types had no influence on starch production in population Ia. In order to confine mt regions responsible for interactions with plastid type cpW/ cpT, the experiment focused on mt recombination types R1 and R2. No other recombinations in potato mitochondrial genomes have been described so far and mitochondrial types of other populations did not show any significant correlations. Further evaluation of differentially segregated mt types might reveal other interactions, in especially male sterility.
Distinct mt DNA conformations seem to influence mitochondrial performance by their compatibilities with the plastid factors. In this respect it is interesting, that plastid type T lacks five open reading frames which exist in the 5´ region of the atpE locus of cp type W (Kawagoe and Kikuta 1991). In maize Newton et al. (1990) showed that mitochondrial factors may play a role also for chloroplast function when they found a mutant mt gene (coxII) which caused an abnormal function of photosystem I. Only an optimized mt-cp configuration allowed an efficient interaction with the new generated cell composition.
It is a question, whether selection pressure works on the level of sugar content in the heterotrophic culture medium. Sugar content in our regeneration media is reduced to one third of the normal concentration in MS medium as a prevention of vitrification effects. This might be a selection pressure, but the bottleneck for cytoplasm performance could also be located in other metabolisms. It is supposed that different compatibility of distinct regions of cp and mt genome is the reason for cytoplasmic interaction: The rare organellar configurations apparently undergo basic problems, reducing vitality during replication of organelles. This could be any missing recognition of regulatory factors encoded by the nucleus, which affects transcript editing, splicing, processing and translation processes. The deviation concerning the duplicated atp6 copy in Population IVa is indicative for an abnormal mt genome replication, which contributes to the superiority of  homogenous mitochondrial genomes (Lössl et al. 1994). Such differences could be due to ´biological costs´, which are associated to nuclear-mitochondrial incompatibilities as reported by McVetty and Pinnisch (1994) for different plasma types in Brassica.
In starch content hybrids with an additional atp6 copy yielded significantly lower than hybrids without this deviation. In this population deviant expression of organellar genomes could be a reason for incompatibilities between cellular compartments. A possible source of variation in this hybrid population is the presence of additional mitochondrial proteins (Lössl et al. 1999). Such deviations in the cytoplasmic expression often are associated with male sterility as a result of mt genome recombinations (Leaver et al. 1988, Köhler et al 1991, Horn and Friedt 1999). The reduction in fertility and vitality is in accordance with the observation quoted above, that hybrids affected from extreme recombinations exhibited lower vigor than hybrids with homogeneous chondriomes.
In this respect it will be of relevance to analyze the mt types on their expression level and to find the reasons for the improved nuclear cytoplasmic interaction.
Thus, cytoplasmic analysis is expected to deliver informations for somatic genetics and is involved in polygenic breeding aims, which are dependent on an optimized nuclear cytoplasmic compatibility. Novel mt-cp-configurations generated by cell fusion may be an enrichment for breeding not only in vegetatively grown plants like potato but also in sexually propagated crops.



 
Figure 1a,b,c. Cytoplasmic types detected by PCR primers. Lanes: 1) Ponto, 2) Adretta, 3) Karlena, 4) Desiree, 5) Sieglinde, 6) Cilena, 7) Assia, 8) Heidrun, 9) Helios, 10). DNA-Standard. DNA product sizes resulting from different PCR primer combinations are given in Table1.
 
 
Cultivar Nr. 
1
2
3
4
5
6
7
8
9
10
Cytoplasm Type
W
a
W
a
W
a
T
b
T
b
T
b
W
g 
W
g
W
g
St.
Figure 1a
Plastid Primers
ALC_1 and ALC_3
differ between cp types T and W.
Lambda Standard (St.) cut with HindIII 
Figure 1b
Mitochondrial Primers 
ALM_4 and ALM_5 
differ between mt types a, b and g.
Lambda Standard (St.) cut with Sty I
Figure 1c
Mitochondrial Primers
ALM_6 and ALM_7
differ between mt types a or b and g. 
Lambda Standard (St.) cut with HindIII.
 



 
Figure 2. Plastid-mitochondrial segregation in population Ia. The mitochondrial genomes of the fusion population consisted of clones with R1 and R2 and homogeneous mt genomes (a/b). The latter subordinated to the main effect of plastids in population Ia, given in Table 4. Configurations R1 and R2 deviated from this effect and therefore were analyzed on further interactions. The ratio is the absolute number of clones simultaneously.

 



 
Figure 3. Interdependence between cp- and mt type R1 or R2 of  a somatic hybrid population in starch yield (kg/plot). Fusion hybrids of population Ia were determined as groups "R1" and "R2" and subgrouped according to their plastid types T or W. Given are the 95% confidence intervals for starch yield [kg] of the four groups for four years.

 

 



 
Table 1. Primer pairs used for identification of cytoplasmic type.  The table gives the primer name, the sequence, the primed region and the product size, specific for W/a, W/g and T/b. ALC primers are used for determination of plastid types, ALM primers for mitochondrial types.
 
Primer
name

ALC_1
ALC_3

ALM_1
ALM_3

ALM_4
ALM_5

ALM_6
ALM_7
 

5´- 3´
Sequence

TAGAATCAGGAGGTCTT
TTACTCACGGCAATC

CACAAATCCATCTTTGTTTATGC
GCGTTGGCTTACAGCGAAACTAG

AATAATCTTCCAAGCGGAGAG
AAGACTCGTGATTCAGGCAAT

ATTTAGGCCCGGCTAGGAACAC
AACCCAGTCCCTATGGTATCTCCT
 

Genome
region

atpE
 

atp6
 

cob, rps10
 

cob

W/a
PCR

622 bp
 

1,2 kb
 

2,4 kb
 

-

 T/b
PCR

381 bp
 

-
 

1,6 kb
 

-

W/g
PCR

622 bp
 

1,2 kb
 

-
 

2,4 kb


 

 



 
Table 2. Frequencies of Plastid-Mitochondrial-Types within the German seed board and haploids. T identifies tuberosum type,  S and W are wild types
 
Mt Type
Cp Type
Percentage in german assortment
a
W
40%
b
T
47%
g
W
10%
d
W
1%
e
S
1%
k
S
1%



 
Table 3. Correlations of effects of different cytoplasms, observed within the spectre of cultivars, in di-haploids and a reciprocal F1 population. Probing was carried out according to Lössl et al. (1999). Replications mean the number of different cultivars and respectively the number of dihaploid clones, which were compared in groups of identical cytoplasm types. Cultivar experiments yielded similar results as published by the official „BundesSortenamt“.
 
 
population cytoplasm 
combination
primers,
probe
correlation
[replications]
P
Trait

Cultivars

    Wa Tb Wg

probe [coxI]
primers: ALM_6/7
        
          Wg  >  Wa   Tb

         [ 19  :   46   +  79 ]

P = 0,01

male sterility
Cultivars     Wa Tb Wg primers: ALM_4/ 5         Wg  >   Wa   Tb
         [19    :    46   +  79 ]
P = 0,01 starch content
Cultivars     Wa Tb Wg primers: ALM_4/ 5       Wg  >  Wa  Tb
       [ 19   :    46   +  79 ]
P = 0,05 starch yield
Di-haploid
breeding 
clones
  Wa Tb Wg
  Wd Se

probe [coxI]
  Wa Wg Wd Se >Tb P = 0,01 starch content
Reciprocal 
Population
    Wa x Wd,
    Wa x Wa
primers: ALM_4/5          Wa > Wd P = 0,01 starch content



 
Table 4 Correlations of different cytoplasmic configurations with starch content, observed within fusion hybrid populations. Probing was carried out according to Lössl et al. (1999).
 
population
 
 

I a
 

I b
 

I c
 

IV b
 

II c
 

III b
 

IVa
 

cytoplasm
combination
 

Wa (+) Tb
 

Wa (+) Tb
 

Wa (+) Tb
 

Wa (+) Se
 

Wa (+) Wg
 

Wa (+) Wd
 

Wa (+) Se
 

primers,
probe
 

primers:ALC_1/3
 

primers:ALC_1/3
 

primers:ALC_1/3
 

probe  [atpE]
 

probe [coxII]
 

probe [rps14]
 

probe [atp6]
 

correlation
replications
.
.
.cpT  > cpW
[270   :   45]

cpW  >cpT
[68   :    42]

cpW = cpT
[5    :    30]

cpS  > cpW
[10   :   54]

a  >  g
[65  :  20]

b >  d > a
[35   : 10  :  5]

    a  >  Dev.* 
[317 :  29]

significance
starch content
 

P = 0,01
 

P = 0,05
 

not significant
 

not significant
 

P = 0,05
 

P = 0,05
 

P = 0,01
 


References

Amoah V, Grun P, Hill JR (1988) Cytoplasmic substitution in Solanum. II. Tuber characteristics of reciprocal backcross progeny. Potato Research 31: 121-127

Cardi T, Bastia T, Monti L, Earle ED (1999) Organelle DNA and male fertility variation in Solanum spp. and interspecific somatic hybrids. Theor. Appl. Genet. 87: 900-908

Donaldson PA, Bevis E, Pandaya RS, Gleddie SC (1994): Random chloroplast segregation and frequent mt DNA rearrangements in fertile somatic hybrids between Nicotiana tabacum L. and N. glutinosa L.. Theor. Appl. Genet.
87: 900-908

Frei U, Stattmann M, Lössl A, Wenzel G (1998) Aspects of fusion combining ability of dihaploid S. tuberosum L.: influence of the cytoplasm. Potato Research 41: 155-162

Glimelius K, Chen K, Bonett T (1981) Somatic hybridization in Nicotiana: Segregation of organellar traits among hybrid and cybrid plants. Planta 153: 504-510

Hilali A, Lauer FI, Veilleux RE (1987) Reciprocal differences between hybrids of Solanum tuberosum groups tuberosum (haploid) and Phureja. Euphytica 36: 631-639

Horn R, Friedt W (1999): CMS sources in sunflower different origin but same mechanism. Theor. Appl. Genet. 98: 195-201.

Horvath G, Thanh N, Rusu A, Raschova L, Medgyesy P (1992) Nucleus-mitochondrion incompatibility drives the DNA recombination mediated adaptation of the mitochondrial genome. HFSP-Workshop, Interaction of three genomes, S. 115, Berlin, 1992

Hosaka K, Hannemann RE (1988): The origin of the cultivated tetraploid potato based on chloroplast DNA. Theor. Appl. Genet. 76: 172-176

Kawagoe Y, Kikuta Y (1991) Chloroplast DNA evolution in potato (Solanum tuberosum L.). Theor. Appl. Genet. 81: 13-20

Köhler R, Horn R, Lössl A, Zetsche K (1991): Cytoplasmic male sterility in sunflower is correlated with the co-transcription of a new open reading frame with the atpA gene. Mol. Gen. Genet. 227: 369-376

Leaver CJ, Isaac PG, Small ID, Bailey-Serres J, Liddell AD, Hawkesford MJ (1988) Mitochondrial genome diversity and cytoplasmic male sterility in higher plants. Philosophical and Trans. R. Soc. London 319: 165-176

Lössl A, Frei U, Wenzel G (1994) Interaction between cytoplasmic composition and yield parameters in somatic hybrids of S. tuberosum L. Theor. Appl. Genet. 89: 873-878

Lössl A (1996) Analyse der DNA Variabilität in Zellorganellen somatischer Fusionshybriden der Kartoffel und deren phänotypische Auswirkungen, PhD Thesis, Technische Universität München, ISBN 3-931713-01-6

Lössl A, Adler N, Horn R, Frei U, Wenzel G (1999): Chondriome Type Characterization of Potato: Mt a, b,g,d,e and Novel Plastid-Mitochondrial Configurations. Theor. Appl. Genet. 99: 1-10

Maris B (1989) Analysis of an incomplete diallel cross among three ssp. tuberosum varieties and seven long-day adapted ssp. andigena clones of the potato (Solanum tuberosum L.). Euphytica 41: 163-182

McVetty PB, Pinnisch R (1994) Comparison of the effect of nap and pol cytoplasms on the performance of three summer oilseed rape cultivar-derived isoline pairs. Can. J. Plant Sci. 74: 729-731

Newton KJ, Knudsen C, Gabay-Laughnan S, Laughnan JR (1990): An abnormal growth mutant in maize has a defective mitochondrial cytochrome oxidase gene. Plant Cell 2: 107-113

Rasmussen JO, Lössl A,  Rasmussen OS, (2000): Analysis of the plastome and chondriome origin in plants regenerated after asymmetric Solanum ssp. protoplast fusions. Theor. Appl. Genet. (in press)

Sanford JC, Hannemann RE (1982) Large yield differences between reciprocal families of Solanum tuberosum. Euphytica  31: 1-12

Sanger F, Nicklen S, Coulson A.R., (1977): DNA sequencing with chain terminating inhibitors; Proc. Natl. Acad. Sci. USA 74: 5463

Schilde-Rentschler L, Kugler-Busch K, Schweis A, Ninnemann H (1995) Somatic hybrids for the study of nuclear cytoplasmic interaction in S. tuberosum. Advances in Plant Breeding 18: 37-48

Spangenberg G, Freydl E, Osusky M, Nagel J, Potrykus I (1991): Organelle transfer by microfusion of defined protoplast-cytoplast pairs; Theor. Appl. Genet. 81: S. 477-486

Stanley RG and Linskens HF (1974) Pollen - Biology, Biochemistry, Management, Springer-Verlag, Berlin, Göttingen, Heidelberg 1974
 


Acknowledgements

The authors are grateful to Mr. A. Barth, Mrs. E. Gerick and C. Kornbauer for technical assistance.
This work was supported by grants of the BMBF under the number 0310768.

Back To Overview
Back to Home Page

Loessl: Cytoplasm Genome Research

Andreas LÖSSL, 20.10.1999